Hemos observado que está utilizando un navegador no compatible. Es posible que el sitio Web de Tripadvisor no se visualice correctamente.Los siguientes navegadores son compatibles con nuestro sitio:
Windows: Internet Explorer, Mozilla Firefox, Google Chrome. Mac: Safari.

Todo lo que necesitas saber sobre las habitaciones
en Villa La Estancia Beach Resort & Spa Riviera Nayarit

Habitación/Suite (523)
10 personas están viendo este hotel
Check-in— / — / —
Check-out— / — / —
Huéspedes1 habitación, 2 adultos, 0 niños
Booking.com
USD 212
Ver oferta
Cancelación sin cargo hasta el 26/05/22
Reserva ahora, paga durante la estadía
Hotels.com
USD 440
Ver oferta
Cancelación sin cargo hasta el 26/05/22
travelup.com
USD 165
Ver oferta
PricelineUSD 203
Trip.comUSD 497
yescapade.comUSD 231
Ver las 21 ofertas
Los precios representan el precio promedio por noche proporcionado por nuestros socios y pueden no incluir todos los impuestos y cargos. Los impuestos y cargos que se muestran son solo aproximados. Consulta con nuestros socios para obtener más detalles.
Puntos destacados de las opiniones de habitaciones
... que ir caminando al siguiente hotel “hermano” (preferí pagar room service) y reservé de una vez la cena del día siguiente....
... anfitriones, le doy un 100 al lugar y a su gente, la suite de lujo, los precios super accesibles, las cervezas muy...
... Alberto, Tony...nos atendieron de maravilla....equipo de room service, siempre atentos y serviciales...reconocimiento...

Opiniones que mencionan habitaciones

Escribir una opinión
Luis L escribió una opinión (mar. de 2022)
Guadalajara, México8 aportes1 voto útil
Se me ofreció una habitación con vista al mar, lo que recibí fue vista de una pared y del otro lado un panel viejo y sucio. La preparación de los alimentos es pésima. Ni un simple guacamole saben preparar, los cocktails desabridos. Si deseas una dieta para diabético hipertenso sin sal ni azúcar este es el lugar, los precios exorbitantes: una langosta 7 mil pesos! De qué estamos hablando? Y el servicio pésimo, tenías que llamarles 2-3 veces para que te atendieran. El refrigerador servi bar del cuarto con 2 botellas de agua! Es una burla. Ah! Y lo olvidaba, el primer día ya no alcancé cena porque ya estaba reservado el único restaurante así que tenía que ir caminando al siguiente hotel “hermano” (preferí pagar room service) y reservé de una vez la cena del día siguiente. Pésima experiencia.
Leer más
Leer menos
Fecha de la estadía: marzo de 2022Tipo de viaje: Viajé
Esta es la opinión subjetiva de un miembro de Tripadvisor, no de TripAdvisor LLC.
Útil
Compartir
Respuesta de Jorge Castro, Director General de Villa La Estancia Beach Resort & Spa Riviera Nayarit
Respondida el 8 de abr. de 2022
Buenos días estimado Luis, lamento que hayas tenido este pequeño inconveniente, de igual manera te agradezco que nos ha elegido como su destino para vacacionar y agradezco sus comentarios sobre la belleza de nuestro hotel, esperamos contar nuevamente con su grata visita y nos permita atenderlo con la calidad y calidez que nos caracteriza. jorge castro Gerente general.
Leer más
Esta respuesta es la opinión subjetiva del representante de la dirección, no de TripAdvisor LLC
Miguel ik S escribió una opinión (feb. de 2022)
1 aporte1 voto útil
Excelente lugar, su gente Mayordomos Hector y Ricardo, los mejores anfitriones, le doy un 100 al lugar y a su gente, la suite de lujo, los precios super accesibles, las cervezas muy frías, gagaggagaggagagagagagaggaaaggagagagagagagagaggaccacaga
Leer más
Leer menos
Fecha de la estadía: febrero de 2022Tipo de viaje: Viajé
Esta es la opinión subjetiva de un miembro de Tripadvisor, no de TripAdvisor LLC.
1 voto útil
Útil
Compartir
Respuesta de Jorge Castro, Director General de Villa La Estancia Beach Resort & Spa Riviera Nayarit
Respondida el 7 de feb. de 2022
Dear Miguel Liks I am very happy to know that your stay with us has been much beyond your expectations, we remain at your service dear Migueliks to serve you with the quality and warmth that characterizes us, it will also be a pleasure to mention the excellent work and attention towards You guys united, I wish you and your beautiful family an exceptional day. Jorge Castro General Manager
Leer más
Esta respuesta es la opinión subjetiva del representante de la dirección, no de TripAdvisor LLC
Aureliano Garcia escribió una opinión (nov. de 2021)
3 aportes
+1
Viajamos en familia, el hotel es de 1er nivel, las habitaciones en perfecto estado, así como todas las instalaciones. Se disfruta al máximo, se ve que lo cuidan mucho...pero sobre todo, el servicio y actitud del equipo de colaboradores es lo que seguramente nos hará regresar. Muchas gracias por todas sus atenciones....Fidel y su equipo de seguridad, Ángeles y su equipo que mantuvieron nuestro depa impecable, todo el equipo de meseros en la alberca y restaurantes, son sensacionales: Jasso, Santana, Ricardo, Nicolas Brianda, Lorena, Alberto, Tony...nos atendieron de maravilla....equipo de room service, siempre atentos y serviciales...reconocimiento especial a Esbai, siempre atento a cualquier solicitud y con una actitud envidiable. Muchas felicidades a todo el equipo de Villa La Estancia...pasamos unas vacaciones increíbles gracias a ustedes!!! Nos vemos pronto!!!
Leer más
Leer menos
Fecha de la estadía: noviembre de 2021Tipo de viaje: Viajé
Esta es la opinión subjetiva de un miembro de Tripadvisor, no de TripAdvisor LLC.
Útil
Compartir
Respuesta de Jorge Castro, Director General de Villa La Estancia Beach Resort & Spa Riviera Nayarit
Respondida el 10 de nov. de 2021
It is a pleasure to greet you again and thank you for choosing us as your vacation destination, I am happy to know that your stay at Villa la Estancia exceeded your expectations, with great pleasure and pride we will congratulate all the staff especially for providing you with high quality hospitality and warmth, you I wish an excellent day Jorge Castro General Manage
Leer más
Esta respuesta es la opinión subjetiva del representante de la dirección, no de TripAdvisor LLC
Victoria Z escribió una opinión (sep. de 2021)
1 aporte
Me encanto todos los platillos de los restaurantes, este hotel se destaca por su comida de alto nivel y el servicio muy amable y atento. Room service 24 horas, las albercas muy limpias y amplias. Nos atendió Esbai Christian Pool Concierge
Leer más
Leer menos
Fecha de la estadía: septiembre de 2021Tipo de viaje: Viajé
Esta es la opinión subjetiva de un miembro de Tripadvisor, no de TripAdvisor LLC.
Útil
Compartir
Respuesta de Jorge Castro, Director General de Villa La Estancia Beach Resort & Spa Riviera Nayarit
Respondida el 24 de sep. de 2021
Estimada Victoriaz817 Gracias por sus valiosos comentarios. Me alegra mucho leer que disfrutó de su estadía en Villa la Estancia, Rivera Nayarit y que mi equipo ha hecho un gran trabajo por parte de todo el personal. Será un honor contar con su regreso y ofrecerle nuestra más sincera hospitalidad en su próxima visita. Atentamente, Jorge Castro Gerente general
Leer más
Esta respuesta es la opinión subjetiva del representante de la dirección, no de TripAdvisor LLC
Estas opiniones se traducen automáticamente del inglés. ¿Quieres ver las traducciones automáticas?
Liesl S escribió una opinión (ago. de 2017)
12 aportes2 votos útiles
+1
"bienvenida a casa" siempre son las primeras palabras que oí cuando vuelva a nuestro sitio favorito de México, Villa La Estancia. Cada verano durante los últimos 8 años, nuestra familia ha hecho este viaje para recargar las baterías y la relajación, y cada verano durante los últimos ocho años la gente en el VLE nos haga sentir que estamos en casa de nuevo. ¿Por dónde empezar? Hay mucho positivo que decir, así que comenzaré con el primero, y probablemente el menos divertido. . . registro. Bueno, al menos te lo espere con un frío vaso de champagne y botellas de icey agua fría. Y una vez que terminen con el negocio de registro, si has comprado el paquete de todo incluido (altamente recomendado) y luego se le entregará un lujoso masaje de aromaterapia mano. Solo puedo decir que todo en este complejo es la aromaterapia? De la lavanda y aromas verbena en los pasillos, al pescado a la parrilla, pollo y carnes provenientes de los restaurantes, todo huele delicioso. Las villas están hermosamente decoradas, diseños modernos y tienen balcones posible, con un montón de espacio para nuestra familia de cuatro. Normalmente nos alojamos en una habitación con dos dormitorios ahora que los niños sean mayores, pero cuando eran jóvenes, de la villa de un dormitorio con un sofá cama estaba bien.
El personal de VLE es impresionante. Son claramente feliz y salir de su camino para asegurarse de que estés contento. De Lucio, Luis, Angel Nicola y Carlos en la parrilla al lado de la piscina, el restaurante, a Miguel, Rogelio, Bernardo, Enzo y Gabriel en La Casona. El personal mak s te hace sentir tan especial y mimado. Fidel y Oscar estaban listos cada día por la piscina con toallas frescas y un sentido del humor. Mi esposo quería agradecer a Félix y Roberto del Tatewari Spa, que es absolutamente necesario, ya sea para un tratamiento de spa (los masajes son maravillosos como son los tratamientos faciales) o simplemente para disfrutar de la sauna y de hidroterapia. El tiempo que pasamos en el tranquilo spa es un mini vacaciones dentro de la vacaciones.
Podría seguir y seguir, pero permítanme decir esto. . No puedes equivocarte al elegir VLE. No podemos esperar a volver el próximo año. Gracias!
Leer más
Leer menos
Fecha de la estadía: julio de 2017Tipo de viaje: Viajé
Consejo sobre las habitaciones: The higher rooms have nicer ocean views without palm trees obstructing the sight of the waves,...
Calidad/precio
Limpieza
Servicio
Language Weaver
Esta es la opinión subjetiva de un miembro de Tripadvisor, no de TripAdvisor LLC.
Útil
Compartir
Esta respuesta es la opinión subjetiva del representante de la dirección, no de TripAdvisor LLC
Anterior
123456